Ötzi, the Iceman
(Pretend you are on the Tyrolean Alps on the border of Austria and Italy)
 
At this place you stand on a high ridge in the remote mountains of Italy on the border with Austria where a Neolithic trader was lost. He met his lonely and icy death 5,300 years ago, and recent evidence suggests his death was the result of wounds acquired in a fight.  On September 19, 1991, two German hikers, Erika and Helmut Simon, stumbled across the well-preserved body of this ancient man trapped in ice for millennia.  Given the name, Ötzi after the Ötzal Alps, this perfectly preserved human is the oldest human ever found in such well preserved condition.   After Ötzi's discovery, a battle between the two countries over ownership of his 5,300-year-old corpse erupted.  The dispute was won by Italy when his resting place was determined to lie a few hundred feet inside its border.  It is widely believed Ötzi was a merchant or trader following an ancient trade route when he met his chilly death.  His Neolithic clothing included a fur cap, deer hide upper garment, fur and deer hide leggings, a leather loincloth, cowhide leather shoes, and a grass coat.  The Iceman’s equipment included a bow-stave, a copper ax, a larch backpack, a leather belt pouch which carried three flint tools; a bone tool; and a piece of tinder.  Among the objects found with the Iceman were fruiting bodies of two fungi.  They were found threaded on a calfskin bracelet associated with the corpse.  There has been much debate about these fungi.  One is unidentifiable, but the other was identified by Austrian mycologists as the fruiting body of the birch fungus (Piptoporus betulinus), common to alpine and other cold locations.  Perhaps this polypore was an ancient medicine kit. The fungus synthesizes polyporic acid C, an effective antibiotic against parasitic bacteria. Also, a British scientist suggested that the polypore could be a vermicide, when during an autopsy he discovered the eggs of the parasitic whipworm, Trichuris trichiura, in Ötzi's colon. This parasite causes diarrhea and abdominal pain. Today the end of Ötzi, the Iceman, has come with a resting place in a refrigerated viewing chamber at the South Tyrol Museum of Archaeology in Bolzano, Italy. 
--J. M. Smith

>gi|987053|emb|Z54154.1|DSPI8SC2 Iceman fungal clone 'Sim C2' 18S rRNA gene (partial) 
GTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAACCTTGGGCCTGGTTGGCGGTCC GCCTCACCGCGTGCACTGGTCCGACCGGGTCTTTCCTTCTGAGGAGCCGCATGCCCTTCAC
TGGGTGTGTCGGGGAATCAGGACTTTTACTTTGAAAAAATTAGAGGTGTTCAAAGCAGGCC
TATGCTCGAATACATTAGCATGGAATAATAGAATAGGACGTGTGGTTCTATTTTGTTGGTTTC TAGGACCGCCGTAATGATTAATAGGGATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGT
GAAATTCTTGGATTTATTGAAGACTAACTACTGCGAAAGCATTTGCCAAGGATGTTTTCATTA ATCAGTGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAA
ACTATGCCGACTAGGGATCGGGCGATGTTATCTTTTTGACTCGCTCGGCACCTTACGAGAAA TCAAAGTCTTTGG
Sequence from cloned DNA of a fungus associated with Otzi the Iceman (GenBank). A BLAST search indicated high similarity with Botrytis cinera, a discomycete conidial fungus associated with plants.
Read more about it:
http://www.american.edu/TED/iceman.htm
http://mr_sedivy.tripod.com/iceman.html
http://dsc.discovery.com/convergence/iceman/iceman.html http://www.indigogroup.co.uk/edge/otzi.htm
 
 

 



Return to Virtual Highway of Biological Historical Markers Index
You write the next one!
Last modified 26 April 2004
Return to Mycology at LSU